circad | circRNAs associated with diseases

hsa_circ_0091017
Gene	TAF1	Organism	Human
Genome Locus	chrX:70601592-70607311:+	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	29151929
Experimental Method
Sample Type	Tissues	Comparison	five matched samples of bladder cancer and adjacent non-tumour tissue
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATCATTCGGACAAGACAGG Reverse TCCATATACCAGATCCTCATTG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Yang, X, Yuan, W, Tao, J, Li, P, Yang, C, Deng, X, Zhang, X, Tang, J, Han, J, Wang, J, Li, P, Lu, Q, Gu, M (2017). Identification of circular RNA signature in bladder cancer. J Cancer, 8, 17:3456-3463.